sgrna2 (Synthego Inc)
Structured Review
Sgrna2, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/sgrna2/sgrna2/us12590320-2306-21-26
Average 86 stars, based on 1 article reviews
Images
Related Articles
Functional Assay:Article Title: CRISPR-Cas9 engineering of human T regulatory cells - Design and optimization of a manufacturing process. Article Snippet: .. Four synthetic sgRNAs that target the NCOA3 gene, encoding for SRC-3, were selected from Synthego’s catalog (Table S1): sgRNA1 was the top overall pick according to vendor’s algorithm, CRISPR:Article Title: A modular circuit coordinates the diversification of courtship strategies Article Snippet: .. Off-targets were determined using CRISPR optimal target finder. sgRNA1 (GACUUUACGAAAGCGCUCCA) and Article Title: Cellular models of and therapies for ocular diseases Article Snippet: In addition to Lonza DS-150 program, other parameters such as CB-150 can also be used. .. Each of expression plasmid construct containing CRISPR g1 or g2 (Item #1 or 2) and CRISPR RNP construct containing sgRNA1 or Synthesized:Article Title: A modular circuit coordinates the diversification of courtship strategies Article Snippet: .. Off-targets were determined using CRISPR optimal target finder. sgRNA1 (GACUUUACGAAAGCGCUCCA) and Article Title: Functional analysis of bovine interleukin-10 receptor alpha in response to Mycobacterium avium subsp. paratuberculosis lysate using CRISPR/Cas9. Article Snippet: Single guide RNA (sgRNAs) targeting bovine IL10RA were designed using the Synthego knockout guide RNA design tool (www.synthego.com). .. Three sgRNAs which were predicted to have with minimal off-target effects were selected (sgRNA1: auggaguagagcccaccucc; Modification:Article Title: A CRISPR and high-content imaging assay compliant with ACMG/AMP guidelines for clinical variant interpretation in ciliopathies. Article Snippet: hTERT-RPE1 cells (ATCC CRL-4000) were cultured in DMEM/F12 (50:50 mix) + 10% FCS at 37 °C, 5% CO2, and split at a ratio of 1:8 once per week. .. Streptococcus pyogenes Cas9 (spCas9) was complexed with one of four modified single-guide RNAs (sgRNAs) targeting intron 4, exon 5 or intron 5 of PRPF31 (Synthego) to form ribonucleoprotein complexes (RNPs). sgRNA sequences were: sgRNA1 TCT GCT CGC CCC CAG GAG CT (PAM GGG), Countercurrent Chromatography:Article Title: A CRISPR and high-content imaging assay compliant with ACMG/AMP guidelines for clinical variant interpretation in ciliopathies. Article Snippet: hTERT-RPE1 cells (ATCC CRL-4000) were cultured in DMEM/F12 (50:50 mix) + 10% FCS at 37 °C, 5% CO2, and split at a ratio of 1:8 once per week. .. Streptococcus pyogenes Cas9 (spCas9) was complexed with one of four modified single-guide RNAs (sgRNAs) targeting intron 4, exon 5 or intron 5 of PRPF31 (Synthego) to form ribonucleoprotein complexes (RNPs). sgRNA sequences were: sgRNA1 TCT GCT CGC CCC CAG GAG CT (PAM GGG), Expressing:Article Title: Cellular models of and therapies for ocular diseases Article Snippet: In addition to Lonza DS-150 program, other parameters such as CB-150 can also be used. .. Each of expression plasmid construct containing CRISPR g1 or g2 (Item #1 or 2) and CRISPR RNP construct containing sgRNA1 or Plasmid Preparation:Article Title: Cellular models of and therapies for ocular diseases Article Snippet: In addition to Lonza DS-150 program, other parameters such as CB-150 can also be used. .. Each of expression plasmid construct containing CRISPR g1 or g2 (Item #1 or 2) and CRISPR RNP construct containing sgRNA1 or Construct:Article Title: Cellular models of and therapies for ocular diseases Article Snippet: In addition to Lonza DS-150 program, other parameters such as CB-150 can also be used. .. Each of expression plasmid construct containing CRISPR g1 or g2 (Item #1 or 2) and CRISPR RNP construct containing sgRNA1 or Mutagenesis:Article Title: Cellular models of and therapies for ocular diseases Article Snippet: In addition to Lonza DS-150 program, other parameters such as CB-150 can also be used. .. Each of expression plasmid construct containing CRISPR g1 or g2 (Item #1 or 2) and CRISPR RNP construct containing sgRNA1 or |
