Review




Structured Review

Synthego Inc sgrna2
Sgrna2, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/sgrna2/sgrna2/us12590320-2306-21-26
Average 86 stars, based on 1 article reviews
sgrna2 - by Bioz Stars, 2026-09
86/100 stars

Images

Related Articles

Functional Assay:

Article Title: CRISPR-Cas9 engineering of human T regulatory cells - Design and optimization of a manufacturing process.
Article Snippet: .. Four synthetic sgRNAs that target the NCOA3 gene, encoding for SRC-3, were selected from Synthego’s catalog (Table S1): sgRNA1 was the top overall pick according to vendor’s algorithm, sgRNA2 had the highest on-target score and sgRNAs 3 and 4 target the two key functional exons of NCOA3 - 11 and 12 respectively (Han et al., 2023; Liu et al., 2008). ..

CRISPR:

Article Title: A modular circuit coordinates the diversification of courtship strategies
Article Snippet: .. Off-targets were determined using CRISPR optimal target finder. sgRNA1 (GACUUUACGAAAGCGCUCCA) and sgRNA2 (ACUGCUGCUGUCCAAAGGAG) were synthesized by Synthego. .. A 1,035 bp 5′ homology arm was amplified from D. yakuba genomic DNA using Q5 High-Fidelity master mix (NEB) and cloned into pIM174 using XmaI and NdeI restriction enzymes.

Article Title: Cellular models of and therapies for ocular diseases
Article Snippet: In addition to Lonza DS-150 program, other parameters such as CB-150 can also be used. .. Each of expression plasmid construct containing CRISPR g1 or g2 (Item #1 or 2) and CRISPR RNP construct containing sgRNA1 or sgRNA2 (Item #4 or 5, Synthego, Silicon Valley, CA, USA) and SpCas9 (Item #9, Catalog #: A034a-a-1000 from Feldan (Quebec, Canada), or from Synthego (e.g., Cas9 nuclease 2NLS, S. pyogenes), alongside a CYP4V2 donor template (Item #7 or #8, ssODN, Ultramer DNA Oligonucleotides, Integrated DNA Technologies (IDT), Coralville, Iowa, USA), is used to transfect patient iPSCs harboring the c.802-8_810del17insGC mutation. ..

Synthesized:

Article Title: A modular circuit coordinates the diversification of courtship strategies
Article Snippet: .. Off-targets were determined using CRISPR optimal target finder. sgRNA1 (GACUUUACGAAAGCGCUCCA) and sgRNA2 (ACUGCUGCUGUCCAAAGGAG) were synthesized by Synthego. .. A 1,035 bp 5′ homology arm was amplified from D. yakuba genomic DNA using Q5 High-Fidelity master mix (NEB) and cloned into pIM174 using XmaI and NdeI restriction enzymes.

Article Title: Functional analysis of bovine interleukin-10 receptor alpha in response to Mycobacterium avium subsp. paratuberculosis lysate using CRISPR/Cas9.
Article Snippet: Single guide RNA (sgRNAs) targeting bovine IL10RA were designed using the Synthego knockout guide RNA design tool (www.synthego.com). .. Three sgRNAs which were predicted to have with minimal off-target effects were selected (sgRNA1: auggaguagagcccaccucc; sgRNA2: ccucuggauggacuuccagg; and sgRNA3: caucuggcuacaccucugga) and custom synthesized by Synthego (Menlo Park, CA, USA). .. Out of three, only sgRNA2 that targets IL10RA exon 3 (www. ensembl.org - ENSBTAT00000006870) was used for transfection.

Modification:

Article Title: A CRISPR and high-content imaging assay compliant with ACMG/AMP guidelines for clinical variant interpretation in ciliopathies.
Article Snippet: hTERT-RPE1 cells (ATCC CRL-4000) were cultured in DMEM/F12 (50:50 mix) + 10% FCS at 37 °C, 5% CO2, and split at a ratio of 1:8 once per week. .. Streptococcus pyogenes Cas9 (spCas9) was complexed with one of four modified single-guide RNAs (sgRNAs) targeting intron 4, exon 5 or intron 5 of PRPF31 (Synthego) to form ribonucleoprotein complexes (RNPs). sgRNA sequences were: sgRNA1 TCT GCT CGC CCC CAG GAG CT (PAM GGG), sgRNA2 CAT TGT TCT TGC ACT TGT CC (PAM AGG), sgRNA3 GAC GAC CAT GAT GGT GGC AT (PAM TGG), and sgRNA4 AGG GAG GCG CCG GGC CCT AA (PAM TGG). sgRNAs had the following modifications to increase stability: 2′-O-methyl analogs and 3′ phosphorothioate internucleotide linkages at the first three 5′ and 3′ terminal RNA residues. .. RNPs were prepared in 1:6 (vol:vol) ratio (protein to modified RNA oligonucleotide) in P3 solution (supplemented) and incubated for 10 min at room temperature prior nucleofecting the cell suspension (100,000 cells/5 μl P3 reagent per reaction, Lonza protocol EA104).

Countercurrent Chromatography:

Article Title: A CRISPR and high-content imaging assay compliant with ACMG/AMP guidelines for clinical variant interpretation in ciliopathies.
Article Snippet: hTERT-RPE1 cells (ATCC CRL-4000) were cultured in DMEM/F12 (50:50 mix) + 10% FCS at 37 °C, 5% CO2, and split at a ratio of 1:8 once per week. .. Streptococcus pyogenes Cas9 (spCas9) was complexed with one of four modified single-guide RNAs (sgRNAs) targeting intron 4, exon 5 or intron 5 of PRPF31 (Synthego) to form ribonucleoprotein complexes (RNPs). sgRNA sequences were: sgRNA1 TCT GCT CGC CCC CAG GAG CT (PAM GGG), sgRNA2 CAT TGT TCT TGC ACT TGT CC (PAM AGG), sgRNA3 GAC GAC CAT GAT GGT GGC AT (PAM TGG), and sgRNA4 AGG GAG GCG CCG GGC CCT AA (PAM TGG). sgRNAs had the following modifications to increase stability: 2′-O-methyl analogs and 3′ phosphorothioate internucleotide linkages at the first three 5′ and 3′ terminal RNA residues. .. RNPs were prepared in 1:6 (vol:vol) ratio (protein to modified RNA oligonucleotide) in P3 solution (supplemented) and incubated for 10 min at room temperature prior nucleofecting the cell suspension (100,000 cells/5 μl P3 reagent per reaction, Lonza protocol EA104).

Expressing:

Article Title: Cellular models of and therapies for ocular diseases
Article Snippet: In addition to Lonza DS-150 program, other parameters such as CB-150 can also be used. .. Each of expression plasmid construct containing CRISPR g1 or g2 (Item #1 or 2) and CRISPR RNP construct containing sgRNA1 or sgRNA2 (Item #4 or 5, Synthego, Silicon Valley, CA, USA) and SpCas9 (Item #9, Catalog #: A034a-a-1000 from Feldan (Quebec, Canada), or from Synthego (e.g., Cas9 nuclease 2NLS, S. pyogenes), alongside a CYP4V2 donor template (Item #7 or #8, ssODN, Ultramer DNA Oligonucleotides, Integrated DNA Technologies (IDT), Coralville, Iowa, USA), is used to transfect patient iPSCs harboring the c.802-8_810del17insGC mutation. ..

Plasmid Preparation:

Article Title: Cellular models of and therapies for ocular diseases
Article Snippet: In addition to Lonza DS-150 program, other parameters such as CB-150 can also be used. .. Each of expression plasmid construct containing CRISPR g1 or g2 (Item #1 or 2) and CRISPR RNP construct containing sgRNA1 or sgRNA2 (Item #4 or 5, Synthego, Silicon Valley, CA, USA) and SpCas9 (Item #9, Catalog #: A034a-a-1000 from Feldan (Quebec, Canada), or from Synthego (e.g., Cas9 nuclease 2NLS, S. pyogenes), alongside a CYP4V2 donor template (Item #7 or #8, ssODN, Ultramer DNA Oligonucleotides, Integrated DNA Technologies (IDT), Coralville, Iowa, USA), is used to transfect patient iPSCs harboring the c.802-8_810del17insGC mutation. ..

Construct:

Article Title: Cellular models of and therapies for ocular diseases
Article Snippet: In addition to Lonza DS-150 program, other parameters such as CB-150 can also be used. .. Each of expression plasmid construct containing CRISPR g1 or g2 (Item #1 or 2) and CRISPR RNP construct containing sgRNA1 or sgRNA2 (Item #4 or 5, Synthego, Silicon Valley, CA, USA) and SpCas9 (Item #9, Catalog #: A034a-a-1000 from Feldan (Quebec, Canada), or from Synthego (e.g., Cas9 nuclease 2NLS, S. pyogenes), alongside a CYP4V2 donor template (Item #7 or #8, ssODN, Ultramer DNA Oligonucleotides, Integrated DNA Technologies (IDT), Coralville, Iowa, USA), is used to transfect patient iPSCs harboring the c.802-8_810del17insGC mutation. ..

Mutagenesis:

Article Title: Cellular models of and therapies for ocular diseases
Article Snippet: In addition to Lonza DS-150 program, other parameters such as CB-150 can also be used. .. Each of expression plasmid construct containing CRISPR g1 or g2 (Item #1 or 2) and CRISPR RNP construct containing sgRNA1 or sgRNA2 (Item #4 or 5, Synthego, Silicon Valley, CA, USA) and SpCas9 (Item #9, Catalog #: A034a-a-1000 from Feldan (Quebec, Canada), or from Synthego (e.g., Cas9 nuclease 2NLS, S. pyogenes), alongside a CYP4V2 donor template (Item #7 or #8, ssODN, Ultramer DNA Oligonucleotides, Integrated DNA Technologies (IDT), Coralville, Iowa, USA), is used to transfect patient iPSCs harboring the c.802-8_810del17insGC mutation. ..



Similar Products

86
Synthego Inc sgrna2
Sgrna2, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/sgrna2/sgrna2/us12590320-2306-21-26
Average 86 stars, based on 1 article reviews
sgrna2 - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

86
Twist Bioscience tobacco rattle virus rna2 ptrv2 vectors ptrv2 sgrna1 sgrna2
a) Developmental expression patterns of AN1 and AN11 . RT-qPCR analysis was performed on flower tissues collected at different developmental stages. DPA, days postanthesis. Data are means ± SEM (n = 3). Significance of differences was calculated by Tukey’s multiple comparison test following one-way ANOVA. Values with different letters are significantly different at P ≤ 0.05. (b and c) Petunia cv. Mitchell flowers were inoculated at anthesis with agrobacteria carrying <t>pTRV2-AN1,</t> pTRV2-AN11 or pTRV2-CHS as a control. Flowers were harvested 2 days after inoculation and subjected to localized headspace sampling followed by GC–MS analysis (b) or RNA extraction followed by RT-qPCR analysis (c) . Data are means ± SEM ( n = 12). Significance of differences was calculated using Dunnett’s test with pTRV2-CHS as the control following one-way ANOVA (b) or two-tailed unpaired Student’s t -test (c) (* P ≤ 0.05, ** P ≤ 0.01, *** P ≤ 0.001). (a and c) RT-qPCR data were normalized to ACTIN , and the presented data were normalized to the sample with the highest expression level. Standard errors are indicated by vertical lines.
Tobacco Rattle Virus Rna2 Ptrv2 Vectors Ptrv2 Sgrna1 Sgrna2, supplied by Twist Bioscience, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/sgrna2/ptrv2+ptrv2+rattle+rna2+sgrna1+sgrna2+tobacco+vectors+virus/bio_rxiv__64898__2026__03__01__708793-298-0-12
Average 86 stars, based on 1 article reviews
tobacco rattle virus rna2 ptrv2 vectors ptrv2 sgrna1 sgrna2 - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

99
Thermo Fisher sgrna2
a) Developmental expression patterns of AN1 and AN11 . RT-qPCR analysis was performed on flower tissues collected at different developmental stages. DPA, days postanthesis. Data are means ± SEM (n = 3). Significance of differences was calculated by Tukey’s multiple comparison test following one-way ANOVA. Values with different letters are significantly different at P ≤ 0.05. (b and c) Petunia cv. Mitchell flowers were inoculated at anthesis with agrobacteria carrying <t>pTRV2-AN1,</t> pTRV2-AN11 or pTRV2-CHS as a control. Flowers were harvested 2 days after inoculation and subjected to localized headspace sampling followed by GC–MS analysis (b) or RNA extraction followed by RT-qPCR analysis (c) . Data are means ± SEM ( n = 12). Significance of differences was calculated using Dunnett’s test with pTRV2-CHS as the control following one-way ANOVA (b) or two-tailed unpaired Student’s t -test (c) (* P ≤ 0.05, ** P ≤ 0.01, *** P ≤ 0.001). (a and c) RT-qPCR data were normalized to ACTIN , and the presented data were normalized to the sample with the highest expression level. Standard errors are indicated by vertical lines.
Sgrna2, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/sgrna2/SUCROSE+EP%2FBP%2FNF+12KG/pm41673416-204-10-30
Average 99 stars, based on 1 article reviews
sgrna2 - by Bioz Stars, 2026-09
99/100 stars
  Buy from Supplier

92
Addgene inc addgene plasmid
a) Developmental expression patterns of AN1 and AN11 . RT-qPCR analysis was performed on flower tissues collected at different developmental stages. DPA, days postanthesis. Data are means ± SEM (n = 3). Significance of differences was calculated by Tukey’s multiple comparison test following one-way ANOVA. Values with different letters are significantly different at P ≤ 0.05. (b and c) Petunia cv. Mitchell flowers were inoculated at anthesis with agrobacteria carrying <t>pTRV2-AN1,</t> pTRV2-AN11 or pTRV2-CHS as a control. Flowers were harvested 2 days after inoculation and subjected to localized headspace sampling followed by GC–MS analysis (b) or RNA extraction followed by RT-qPCR analysis (c) . Data are means ± SEM ( n = 12). Significance of differences was calculated using Dunnett’s test with pTRV2-CHS as the control following one-way ANOVA (b) or two-tailed unpaired Student’s t -test (c) (* P ≤ 0.05, ** P ≤ 0.01, *** P ≤ 0.001). (a and c) RT-qPCR data were normalized to ACTIN , and the presented data were normalized to the sample with the highest expression level. Standard errors are indicated by vertical lines.
Addgene Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/sgrna2/pUAS%3ACas9T2ACre%3BU6%3AsgRNA1%3BU6%3AsgRNA2+(Plasmid+%2374010)/pmc12823065-25-12-12
Average 92 stars, based on 1 article reviews
addgene plasmid - by Bioz Stars, 2026-09
92/100 stars
  Buy from Supplier

92
Addgene inc u6 sgrna1
a) Developmental expression patterns of AN1 and AN11 . RT-qPCR analysis was performed on flower tissues collected at different developmental stages. DPA, days postanthesis. Data are means ± SEM (n = 3). Significance of differences was calculated by Tukey’s multiple comparison test following one-way ANOVA. Values with different letters are significantly different at P ≤ 0.05. (b and c) Petunia cv. Mitchell flowers were inoculated at anthesis with agrobacteria carrying <t>pTRV2-AN1,</t> pTRV2-AN11 or pTRV2-CHS as a control. Flowers were harvested 2 days after inoculation and subjected to localized headspace sampling followed by GC–MS analysis (b) or RNA extraction followed by RT-qPCR analysis (c) . Data are means ± SEM ( n = 12). Significance of differences was calculated using Dunnett’s test with pTRV2-CHS as the control following one-way ANOVA (b) or two-tailed unpaired Student’s t -test (c) (* P ≤ 0.05, ** P ≤ 0.01, *** P ≤ 0.001). (a and c) RT-qPCR data were normalized to ACTIN , and the presented data were normalized to the sample with the highest expression level. Standard errors are indicated by vertical lines.
U6 Sgrna1, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/sgrna2/pUAS%3ACas9T2ACre%3BU6%3AsgRNA1%3BU6%3AsgRNA2+(Plasmid+%2374010)/pmc12823065-25-6-12
Average 92 stars, based on 1 article reviews
u6 sgrna1 - by Bioz Stars, 2026-09
92/100 stars
  Buy from Supplier

86
Synthego Inc sgrna2 gcuguaaugaagguccccca
a) Developmental expression patterns of AN1 and AN11 . RT-qPCR analysis was performed on flower tissues collected at different developmental stages. DPA, days postanthesis. Data are means ± SEM (n = 3). Significance of differences was calculated by Tukey’s multiple comparison test following one-way ANOVA. Values with different letters are significantly different at P ≤ 0.05. (b and c) Petunia cv. Mitchell flowers were inoculated at anthesis with agrobacteria carrying <t>pTRV2-AN1,</t> pTRV2-AN11 or pTRV2-CHS as a control. Flowers were harvested 2 days after inoculation and subjected to localized headspace sampling followed by GC–MS analysis (b) or RNA extraction followed by RT-qPCR analysis (c) . Data are means ± SEM ( n = 12). Significance of differences was calculated using Dunnett’s test with pTRV2-CHS as the control following one-way ANOVA (b) or two-tailed unpaired Student’s t -test (c) (* P ≤ 0.05, ** P ≤ 0.01, *** P ≤ 0.001). (a and c) RT-qPCR data were normalized to ACTIN , and the presented data were normalized to the sample with the highest expression level. Standard errors are indicated by vertical lines.
Sgrna2 Gcuguaaugaagguccccca, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/sgrna2/2+a+gauuccugcaaccugcucca+n+sgrna+sirt1+synthego/pmc11652221-435-52-48
Average 86 stars, based on 1 article reviews
sgrna2 gcuguaaugaagguccccca - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

93
Cyagen Biosciences tctcgccgactttgggcgcc agg cyagen n a mouse tfeb sgrna2 sequence
a) Developmental expression patterns of AN1 and AN11 . RT-qPCR analysis was performed on flower tissues collected at different developmental stages. DPA, days postanthesis. Data are means ± SEM (n = 3). Significance of differences was calculated by Tukey’s multiple comparison test following one-way ANOVA. Values with different letters are significantly different at P ≤ 0.05. (b and c) Petunia cv. Mitchell flowers were inoculated at anthesis with agrobacteria carrying <t>pTRV2-AN1,</t> pTRV2-AN11 or pTRV2-CHS as a control. Flowers were harvested 2 days after inoculation and subjected to localized headspace sampling followed by GC–MS analysis (b) or RNA extraction followed by RT-qPCR analysis (c) . Data are means ± SEM ( n = 12). Significance of differences was calculated using Dunnett’s test with pTRV2-CHS as the control following one-way ANOVA (b) or two-tailed unpaired Student’s t -test (c) (* P ≤ 0.05, ** P ≤ 0.01, *** P ≤ 0.001). (a and c) RT-qPCR data were normalized to ACTIN , and the presented data were normalized to the sample with the highest expression level. Standard errors are indicated by vertical lines.
Tctcgccgactttgggcgcc Agg Cyagen N A Mouse Tfeb Sgrna2 Sequence, supplied by Cyagen Biosciences, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/sgrna2/Tfeb/pmc12614383__hep-82-1534-s001-183-7-8
Average 93 stars, based on 1 article reviews
tctcgccgactttgggcgcc agg cyagen n a mouse tfeb sgrna2 sequence - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier

93
Addgene inc puas cas9t2agfp
a) Developmental expression patterns of AN1 and AN11 . RT-qPCR analysis was performed on flower tissues collected at different developmental stages. DPA, days postanthesis. Data are means ± SEM (n = 3). Significance of differences was calculated by Tukey’s multiple comparison test following one-way ANOVA. Values with different letters are significantly different at P ≤ 0.05. (b and c) Petunia cv. Mitchell flowers were inoculated at anthesis with agrobacteria carrying <t>pTRV2-AN1,</t> pTRV2-AN11 or pTRV2-CHS as a control. Flowers were harvested 2 days after inoculation and subjected to localized headspace sampling followed by GC–MS analysis (b) or RNA extraction followed by RT-qPCR analysis (c) . Data are means ± SEM ( n = 12). Significance of differences was calculated using Dunnett’s test with pTRV2-CHS as the control following one-way ANOVA (b) or two-tailed unpaired Student’s t -test (c) (* P ≤ 0.05, ** P ≤ 0.01, *** P ≤ 0.001). (a and c) RT-qPCR data were normalized to ACTIN , and the presented data were normalized to the sample with the highest expression level. Standard errors are indicated by vertical lines.
Puas Cas9t2agfp, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/sgrna2/pUAS%3ACas9T2AGFP%3BU6%3AsgRNA1%3BU6%3AsgRNA2+(Plasmid+%2374009)/pmc12549914__41467_2025_64448_MOESM1_ESM-57-23-25
Average 93 stars, based on 1 article reviews
puas cas9t2agfp - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier

Image Search Results


a) Developmental expression patterns of AN1 and AN11 . RT-qPCR analysis was performed on flower tissues collected at different developmental stages. DPA, days postanthesis. Data are means ± SEM (n = 3). Significance of differences was calculated by Tukey’s multiple comparison test following one-way ANOVA. Values with different letters are significantly different at P ≤ 0.05. (b and c) Petunia cv. Mitchell flowers were inoculated at anthesis with agrobacteria carrying pTRV2-AN1, pTRV2-AN11 or pTRV2-CHS as a control. Flowers were harvested 2 days after inoculation and subjected to localized headspace sampling followed by GC–MS analysis (b) or RNA extraction followed by RT-qPCR analysis (c) . Data are means ± SEM ( n = 12). Significance of differences was calculated using Dunnett’s test with pTRV2-CHS as the control following one-way ANOVA (b) or two-tailed unpaired Student’s t -test (c) (* P ≤ 0.05, ** P ≤ 0.01, *** P ≤ 0.001). (a and c) RT-qPCR data were normalized to ACTIN , and the presented data were normalized to the sample with the highest expression level. Standard errors are indicated by vertical lines.

Journal: bioRxiv

Article Title: The MBW complex regulates volatiles in petunia flowers: EOBV interacts with AN1 to suppress biosynthesis of phenylpropenes

doi: 10.64898/2026.03.01.708793

Figure Lengend Snippet: a) Developmental expression patterns of AN1 and AN11 . RT-qPCR analysis was performed on flower tissues collected at different developmental stages. DPA, days postanthesis. Data are means ± SEM (n = 3). Significance of differences was calculated by Tukey’s multiple comparison test following one-way ANOVA. Values with different letters are significantly different at P ≤ 0.05. (b and c) Petunia cv. Mitchell flowers were inoculated at anthesis with agrobacteria carrying pTRV2-AN1, pTRV2-AN11 or pTRV2-CHS as a control. Flowers were harvested 2 days after inoculation and subjected to localized headspace sampling followed by GC–MS analysis (b) or RNA extraction followed by RT-qPCR analysis (c) . Data are means ± SEM ( n = 12). Significance of differences was calculated using Dunnett’s test with pTRV2-CHS as the control following one-way ANOVA (b) or two-tailed unpaired Student’s t -test (c) (* P ≤ 0.05, ** P ≤ 0.01, *** P ≤ 0.001). (a and c) RT-qPCR data were normalized to ACTIN , and the presented data were normalized to the sample with the highest expression level. Standard errors are indicated by vertical lines.

Article Snippet: Tobacco rattle virus RNA2 (pTRV2) vectors pTRV2-sgRNA1-sgRNA2 and pTRV2-sgRNA1-sgRNA3, were synthesized by Twist Bioscience (San Francisco, CA, USA), based on the pTRV2 vector with GenBank accession AF406991 .

Techniques: Expressing, Quantitative RT-PCR, Comparison, Control, Sampling, Gas Chromatography-Mass Spectrometry, RNA Extraction, Two Tailed Test

a) Phylogenetic tree displaying the similarity between EOBV and subgroup 4 R2R3-MYBs from other plants. Protein sequences were aligned by ClustalW, followed by neighbor-joining method with 1000 bootstraps using MEGA version 11. b) Nuclear localization of EOBV in petal epidermal cells by confocal microscopy. Petunia petals were inoculated with agrobacteria carrying EOBV-GFP or GFP-EOBV and RFP - NLS, or only RFP - NLS as a control. Bars = 10 μm. BF = bright field. NLS, nuclear localization signal. c) Expression of EOBV in different plant organs. Tissues from different organs were collected at 1100 h. RT-qPCR data were normalized to ACTIN , and the presented data were normalized to the sample with the highest expression level. Significance of differences was calculated by Tukey’s multiple comparison test following one-way ANOVA. Values with different letters are significantly different at P ≤ 0.05. d) EOBV transcripts are enriched in the petal adaxial epidermis. Normalized counts in the petal adaxial epidermis (purple bars) vs. whole petal (gray bars) based on the transcriptome data from Skaliter et al . (2024) . Significance of differences was calculated by two-tailed unpaired Student’s t -test: * P ≤ 0.05. EVER, EPIDERMIS VOLATILE EMISSION REGULATOR. CAB, CHLOROPHYLL A/B BINDING PROTEIN. e) Transient suppression of EOBV in petunia cv. Mitchell flowers inoculated with agrobacteria carrying pTRV2-CHS as a control or pTRV2-EOBV. Flowers were harvested 2 days after inoculation and subjected to localized headspace sampling followed by GC–MS analysis or RNA extraction followed by RT-qPCR analysis (inset). Data are means ± SEM ( n = 11–12). RT-qPCR data were normalized to ACTIN , and the presented data were normalized to those from pTRV2-CHS. Significance of differences between treatments was calculated by two-tailed unpaired Student’s t -test: (* P ≤ 0.05, ** P ≤ 0.01, *** P ≤ 0.001). Standard errors are indicated by vertical lines.

Journal: bioRxiv

Article Title: The MBW complex regulates volatiles in petunia flowers: EOBV interacts with AN1 to suppress biosynthesis of phenylpropenes

doi: 10.64898/2026.03.01.708793

Figure Lengend Snippet: a) Phylogenetic tree displaying the similarity between EOBV and subgroup 4 R2R3-MYBs from other plants. Protein sequences were aligned by ClustalW, followed by neighbor-joining method with 1000 bootstraps using MEGA version 11. b) Nuclear localization of EOBV in petal epidermal cells by confocal microscopy. Petunia petals were inoculated with agrobacteria carrying EOBV-GFP or GFP-EOBV and RFP - NLS, or only RFP - NLS as a control. Bars = 10 μm. BF = bright field. NLS, nuclear localization signal. c) Expression of EOBV in different plant organs. Tissues from different organs were collected at 1100 h. RT-qPCR data were normalized to ACTIN , and the presented data were normalized to the sample with the highest expression level. Significance of differences was calculated by Tukey’s multiple comparison test following one-way ANOVA. Values with different letters are significantly different at P ≤ 0.05. d) EOBV transcripts are enriched in the petal adaxial epidermis. Normalized counts in the petal adaxial epidermis (purple bars) vs. whole petal (gray bars) based on the transcriptome data from Skaliter et al . (2024) . Significance of differences was calculated by two-tailed unpaired Student’s t -test: * P ≤ 0.05. EVER, EPIDERMIS VOLATILE EMISSION REGULATOR. CAB, CHLOROPHYLL A/B BINDING PROTEIN. e) Transient suppression of EOBV in petunia cv. Mitchell flowers inoculated with agrobacteria carrying pTRV2-CHS as a control or pTRV2-EOBV. Flowers were harvested 2 days after inoculation and subjected to localized headspace sampling followed by GC–MS analysis or RNA extraction followed by RT-qPCR analysis (inset). Data are means ± SEM ( n = 11–12). RT-qPCR data were normalized to ACTIN , and the presented data were normalized to those from pTRV2-CHS. Significance of differences between treatments was calculated by two-tailed unpaired Student’s t -test: (* P ≤ 0.05, ** P ≤ 0.01, *** P ≤ 0.001). Standard errors are indicated by vertical lines.

Article Snippet: Tobacco rattle virus RNA2 (pTRV2) vectors pTRV2-sgRNA1-sgRNA2 and pTRV2-sgRNA1-sgRNA3, were synthesized by Twist Bioscience (San Francisco, CA, USA), based on the pTRV2 vector with GenBank accession AF406991 .

Techniques: Confocal Microscopy, Control, Expressing, Quantitative RT-PCR, Comparison, Two Tailed Test, Binding Assay, Sampling, Gas Chromatography-Mass Spectrometry, RNA Extraction

a) Schematic representation of the genomic sequence of EOBV and location of the three Cas9 target sites. b) Top: schematic representation of the T-DNA carrying tobacco rattle virus RNA2 (pTRV2) vectors used used for gene editing. SGP, subgenomic promoter; LB, left border; 35S-P, cauliflower mosaic virus 35S promoter; SGP, subgenomic promoter; sgRNA, single guide RNA; NOS-T, nopaline synthase terminator; RB, right border; Cas9, human co-don-optimized Cas9 gene. Bottom: targeted genomic sequences and Sanger sequencing of eobv -knockout lines. Green nucleotides, spacer sequences; red nucleotides, protospacer adjacent motif (PAM). Black arrows mark the predicted cleavage site of Cas9. Magenta box, EOBV start codon. c) Predicted EOBV protein product in eobv -knockout and wild-type (WT) lines. Functional domains are indicated by colored rectangles. Numbers denote amino acid positions. d) Representative petunia cv. Mitchell flowers 2 days postanthesis from control Cas9 and eobv lines. Bar = 1 cm.

Journal: bioRxiv

Article Title: The MBW complex regulates volatiles in petunia flowers: EOBV interacts with AN1 to suppress biosynthesis of phenylpropenes

doi: 10.64898/2026.03.01.708793

Figure Lengend Snippet: a) Schematic representation of the genomic sequence of EOBV and location of the three Cas9 target sites. b) Top: schematic representation of the T-DNA carrying tobacco rattle virus RNA2 (pTRV2) vectors used used for gene editing. SGP, subgenomic promoter; LB, left border; 35S-P, cauliflower mosaic virus 35S promoter; SGP, subgenomic promoter; sgRNA, single guide RNA; NOS-T, nopaline synthase terminator; RB, right border; Cas9, human co-don-optimized Cas9 gene. Bottom: targeted genomic sequences and Sanger sequencing of eobv -knockout lines. Green nucleotides, spacer sequences; red nucleotides, protospacer adjacent motif (PAM). Black arrows mark the predicted cleavage site of Cas9. Magenta box, EOBV start codon. c) Predicted EOBV protein product in eobv -knockout and wild-type (WT) lines. Functional domains are indicated by colored rectangles. Numbers denote amino acid positions. d) Representative petunia cv. Mitchell flowers 2 days postanthesis from control Cas9 and eobv lines. Bar = 1 cm.

Article Snippet: Tobacco rattle virus RNA2 (pTRV2) vectors pTRV2-sgRNA1-sgRNA2 and pTRV2-sgRNA1-sgRNA3, were synthesized by Twist Bioscience (San Francisco, CA, USA), based on the pTRV2 vector with GenBank accession AF406991 .

Techniques: Sequencing, Virus, Genomic Sequencing, Knock-Out, Functional Assay, Control